D11Mit60 Primer Detail MGI Mouse MGI:702452

D11Mit60 Primer Detail

Name

D11Mit60
Primer 1 Sequence

AGAGAGGCAAAAATTCCAAGC
Primer 2 Sequence

CTTCCTGATGGTAGGATTTAGGC
ID

MGI:702452
Product Size

301
Other IDs

D11Mit60 (BROAD)
Note

MIT assay: D633
Additional information: MIT STS Marker Data Files

D11Mit60

DNA segment, Chr 11, Massachusetts Institute of Technology 60

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit60	b	larger	C57BL/6J
	D11Mit60	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit60	a	308bp	A/J, AKR/J, BALB/cJ, CAST/EiJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	b	312bp	C3H/HeJ
	c	316bp	B6.Cg-Lep^ob/+, C57BL/6J
	d	344bp	SPRET/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/09/2024 MGI 6.24