D11Mit67 Primer Detail MGI Mouse MGI:702455

D11Mit67 Primer Detail

Name

D11Mit67
Primer 1 Sequence

AAAAAAAAAAAGTTCAAGGCTGG
Primer 2 Sequence

GGAACTCAACTCCTAGAACTTCTG
ID

MGI:702455
Product Size

134
Other IDs

D11Mit67 (BROAD)
Note

MIT assay: B654
Additional information: MIT STS Marker Data Files

D11Mit67

DNA segment, Chr 11, Massachusetts Institute of Technology 67

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D11Mit67	a	126bp	129X1/Sv
Not Specified	D11Mit67	f	126, 136bp	CD-1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit67	c	126bp	C3HeB/FeJLe
	D11Mit67	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit67	a	126bp	C3H/HeJ, DBA/2J, LP/J
	b	134bp	B6.Cg-Lep^ob/+, C57BL/6J
	c	136bp	BALB/cJ, NOD/MrkTac, NON/ShiLt
	d	152bp	SPRET/EiJ
	e	178bp	A/J, AKR/J, CAST/EiJ

J:71432 Schwarz M, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit67	a	smaller	129P3/J
	D11Mit67	s	larger	SJL/J

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24