D11Mit69 Primer Detail MGI Mouse MGI:702460

D11Mit69 Primer Detail

Name

D11Mit69
Primer 1 Sequence

AGTTGCTGCAATATGGACCC
Primer 2 Sequence

ATCTCAGTGCTGTTCTAACACTGC
ID

MGI:702460
Product Size

167
Other IDs

D11Mit69 (BROAD)
Note

MIT assay: B526
Additional information: MIT STS Marker Data Files

D11Mit69

DNA segment, Chr 11, Massachusetts Institute of Technology 69

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D11Mit69	m	168bp	MOLF/EiJ
Not Specified	D11Mit69	s	159bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit69	a	160bp	SPRET/EiJ
	b	174bp	LP/J
	c	176bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt
	d	180bp	CAST/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit69	c	196bp	CBA/CaOlaHsd
	D11Mit69	s	193bp	SWR/OlaHsd

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24