D3Mit102 Primer Detail MGI Mouse MGI:702467

D3Mit102 Primer Detail

Name

D3Mit102
Primer 1 Sequence

GGCTCGCTGGTTGGTTTTAC
Primer 2 Sequence

GGGCTCCTACATGCATGAAT
ID

MGI:702467
Product Size

150
Other IDs

D3Mit102 (BROAD)
Note

MIT assay: MPC2604
Additional information: MIT STS Marker Data Files

D3Mit102

DNA segment, Chr 3, Massachusetts Institute of Technology 102

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit102	a	134bp	NON/ShiLt
	b	142bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac
	c	152bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J
	d	162bp	CAST/EiJ, SPRET/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit102	a	152bp	C57BL/6W, C57BL/10W, DBA/2W
	D3Mit102	b	142bp	129/SvW, A.CA/W, AKR/W, BALB/cW, BN/aW, C3H/W, CBA/W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24