D1Mit30 Primer Detail MGI Mouse MGI:702469

D1Mit30 Primer Detail

Name

D1Mit30
Primer 1 Sequence

TGAACCATCACCATGCTGTT
Primer 2 Sequence

TGGGCTGCGTTTCTAAGG
ID

MGI:702469
Product Size

101
Other IDs

D1Mit30 (BROAD)
Note

MIT assay: P100
Additional information: MIT STS Marker Data Files

D1Mit30

DNA segment, Chr 1, Massachusetts Institute of Technology 30

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D1Mit30	b	smaller than f	C57BL/6J
	c	104bp	C3HeB/FeJLe
	f	larger than c and b	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit30	a	102bp	SPRET/EiJ
	b	104bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, LP/J, NON/ShiLt
	c	120bp	AKR/J, DBA/2J
	d	122bp	CAST/EiJ, NOD/MrkTac

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit30	a	120bp	AKR/W, BN/aW, DBA/2W
	D1Mit30	b	104bp	129/SvW, A.CA/W, BALB/cW, C3H/W, C57BL/6W, C57BL/10W, CBA/W

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/05/2024 MGI 6.24