D17Mit213 Primer Detail MGI Mouse MGI:702476

D17Mit213 Primer Detail

Name

D17Mit213
Primer 1 Sequence

AAACACAAATAGATACAAAGACACACG
Primer 2 Sequence

TTAACCTGTGAGTCCTTTGATGG
ID

MGI:702476
Product Size

124
Other IDs

D17Mit213 (BROAD)
Note

MIT assay: MTH515
Additional information: MIT STS Marker Data Files

DNA segment, Chr 17, Massachusetts Institute of Technology 213

J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4

Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit213	b	124bp	C57BL/6J
Not Specified	D17Mit213	s	114bp	129X1/SvJ, BALB/cJ

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit213	a	114bp	A/J, BALB/cJ, DBA/2J, LP/J, NON/ShiLt
	b	124bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac
	c	128bp	C3H/HeJ
	d	142bp	CAST/EiJ, SPRET/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit213	c	141bp	CBA/CaOlaHsd
	D17Mit213	s	139bp	SWR/OlaHsd

J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24