D17Mit215 Primer Detail MGI Mouse MGI:702495

D17Mit215 Primer Detail

Name

D17Mit215
Primer 1 Sequence

TACTTTGCTCAGTTTCATGTGTTG
Primer 2 Sequence

GGAGTCTTAAAAAGTTTCCAGTGG
ID

MGI:702495
Product Size

102
Other IDs

D17Mit215 (BROAD)
Note

MIT assay: MTH561
Additional information: MIT STS Marker Data Files

DNA segment, Chr 17, Massachusetts Institute of Technology 215

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit215	a	94bp	AKR/J, C3H/HeJ
	b	104bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt
	c	106bp	LP/J
	d	108bp	SPRET/EiJ
	e	134bp	CAST/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D17Mit215	a	154bp	129/SvW
	b	110bp	BN/aW
	c	104bp	A.CA/W, BALB/cW, C57BL/6W, C57BL/10W, DBA/2W
	d	94bp	AKR/W, C3H/W, CBA/W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24