D7Mit145 Primer Detail MGI Mouse MGI:702497

D7Mit145 Primer Detail

Name

D7Mit145
Primer 1 Sequence

CAGGTGACCTTGGTCATGG
Primer 2 Sequence

AGAGCCCAGGGGTTTTAAGA
ID

MGI:702497
Product Size

199
Other IDs

D7Mit145 (BROAD)
Note

MIT assay: MT479
Additional information: MIT STS Marker Data Files

D7Mit145

DNA segment, Chr 7, Massachusetts Institute of Technology 145

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D7Mit145	a	149bp	BALB/cJ, C3H/HeJ, CAST/EiJ, LP/J, NON/ShiLt
	b	155bp	AKR/J, NOD/MrkTac
	c	157bp	A/J, DBA/2J
	d	161bp	SPRET/EiJ
	e	189bp	B6.Cg-Lep^ob/+, C57BL/6J

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D7Mit145	b	202bp	C57BL/6JOlaHsd, C57BL/10
	c	144bp	A/JOlaHsd, AKR/OlaHsd, BALB/cJ
	d	148bp	129P3/J, C3H/HeJ, DBA/2J
	j	134bp	JF1
	l	146bp	SJL/J
	p	136bp	PWB

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24