D16Mit158 Primer Detail MGI Mouse MGI:702505

D16Mit158 Primer Detail

Name

D16Mit158
Primer 1 Sequence

AAGAAGGTGGTGGTTGCTGT
Primer 2 Sequence

ACTATCCACACCCATCTTAAGAGC
ID

MGI:702505
Product Size

137
Other IDs

D16Mit158 (BROAD)
Note

MIT assay: MT3616
Additional information: MIT STS Marker Data Files

DNA segment, Chr 16, Massachusetts Institute of Technology 158

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D16Mit158	a	156bp	129X1/Sv
Not Specified	D16Mit158	f	140, 156bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D16Mit158	a	140bp	AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J
	b	154bp	DBA/2J
	c	156bp	A/J, CAST/EiJ, LP/J, NOD/MrkTac, NON/ShiLt
	d	164bp	SPRET/EiJ

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24