About   Help   FAQ
D8Mit25 Primer Detail
Primers
  • Name
    D8Mit25
  • Primer 1 Sequence
    TCAGACTAATGTCCAGTAGCAAGC
  • Primer 2 Sequence
    ATTGCATGTCCATGTCTGGA
  • ID
    MGI:702564
  • Product Size
    118
  • Other IDs
    D8Mit25 (BROAD)
  • Note
    MIT assay: A780
    Additional information: MIT STS Marker Data Files
Genes
D8Mit25 DNA segment, Chr 8, Massachusetts Institute of Technology 25
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D8Mit25 c 130bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit25 a 108bp SPRET/EiJ
b 120bp B6.Cg-Lepob/+, C57BL/6J
c 126bp A/J, NOD/MrkTac, NON/ShiLt
d 130bp AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J
e 132bp CAST/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D8Mit25 l larger LG/J
s smaller SM/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D8Mit25 c 116bp CBA/CaOlaHsd
s 118bp SWR/OlaHsd
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
11/12/2024
MGI 6.24 		The Jackson Laboratory