D17Mit205 Primer Detail MGI Mouse MGI:702569

D17Mit205 Primer Detail

Name

D17Mit205
Primer 1 Sequence

TGTGCATGTATATGTGTGTGAATG
Primer 2 Sequence

GCTAAGTCAGAAGAGTTCTGTAATGG
ID

MGI:702569
Product Size

223
Other IDs

D17Mit205 (BROAD)
Note

MIT assay: MTH364
Additional information: MIT STS Marker Data Files

DNA segment, Chr 17, Massachusetts Institute of Technology 205

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit205	a	180bp	SPRET/EiJ
	b	213bp	LP/J
	c	215bp	DBA/2J
	d	219bp	A/J, AKR/J, BALB/cJ, NOD/MrkTac
	e	223bp	B6.Cg-Lep^ob/+, C57BL/6J, NON/ShiLt
	f	225bp	CAST/EiJ

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit205	c	smaller	CBA/Kw
	D17Mit205	e	larger	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24