D5Mit101 Primer Detail MGI Mouse MGI:702580

D5Mit101 Primer Detail

Name

D5Mit101
Primer 1 Sequence

GGGATGACGTTTGAGGTTGT
Primer 2 Sequence

CTGCTTGGGATGTGGGTC
ID

MGI:702580
Product Size

132
Other IDs

D5Mit101 (BROAD)
Note

MIT assay: MPC839
Additional information: MIT STS Marker Data Files

D5Mit101

DNA segment, Chr 5, Massachusetts Institute of Technology 101

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D5Mit101	a	130bp	129X1/Sv
Not Specified	D5Mit101	f	118, 130bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit101	a	118bp	A/J, BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac
	b	130bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, NON/ShiLt
	c	134bp	AKR/J
	d	138bp	CAST/EiJ
	e	154bp	SPRET/EiJ

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 08/02/2024 MGI 6.24