D13Mit5 Primer Detail MGI Mouse MGI:702583

D13Mit5 Primer Detail

Name

D13Mit5
Primer 1 Sequence

AGAAGCCAGCAGGTGTTTTC
Primer 2 Sequence

CCAGGAAGTAACCCCAAACA
ID

MGI:702583
Product Size

190
Note

MIT assay: M38

D13Mit5

DNA segment, Chr 13, Massachusetts Institute of Technology 5

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D13Mit5	a	largest	JF1, MSM/Ms
Not Specified	D13Mit5	b	smaller	C57BL/6, DBA/2

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Endonuclease	Gene	Allele	Fragments	Strains
	D13Mit5	a	190bp	CAST/EiJ
	D13Mit5	b	194bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/24/2024 MGI 6.24