D8Mit190 Primer Detail MGI Mouse MGI:702601

D8Mit190 Primer Detail

Name

D8Mit190
Primer 1 Sequence

CTTTGTTGCTGTTTCATTCTGG
Primer 2 Sequence

AGTCATATACAAGGTCAACCTGAGC
ID

MGI:702601
Product Size

133
Other IDs

D8Mit190 (BROAD)
Note

MIT assay: MT2951
Additional information: MIT STS Marker Data Files

D8Mit190

DNA segment, Chr 8, Massachusetts Institute of Technology 190

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D8Mit190	b	larger	C57BL/6J
	D8Mit190	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D8Mit190	a	98bp	A/J, AKR/J, BALB/cJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt, SPRET/EiJ
	b	116bp	C3H/HeJ
	c	122bp	CAST/EiJ
	d	138bp	B6.Cg-Lep^ob/+, C57BL/6J

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D8Mit190	c	lower	CBA/Kw
	D8Mit190	e	upper	KE

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 08/02/2024 MGI 6.24