About   Help   FAQ
D8Mit191 Primer Detail
Primers
  • Name
    D8Mit191
  • Primer 1 Sequence
    CAAAGCAAGTGAAACTAGATGTTAGC
  • Primer 2 Sequence
    GCAGAACGAAACAATGCTAGC
  • ID
    MGI:702602
  • Product Size
    138
  • Other IDs
    D8Mit191 (BROAD)
  • Note
    MIT assay: MT3114
    Additional information: MIT STS Marker Data Files
Genes
D8Mit191 DNA segment, Chr 8, Massachusetts Institute of Technology 191
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D8Mit191 c 132bp C3HeB/FeJLe
f larger FVB/N
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D8Mit191 c 141bp CBA/CaOlaHsd
s 128bp SWR/OlaHsd
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory