D10Mit183 Primer Detail MGI Mouse MGI:702624

D10Mit183 Primer Detail

Name

D10Mit183
Primer 1 Sequence

GGTGCCATGGGTAGACATG
Primer 2 Sequence

CCCCTTTAAGAAAGGAAGTAGTCC
ID

MGI:702624
Product Size

139
Other IDs

D10Mit183 (BROAD)
Note

MIT assay: MT3341
Additional information: MIT STS Marker Data Files

D10Mit183a	DNA segment, Chr 10, Massachusetts Institute of Technology 183a
D10Mit183b	DNA segment, Chr 10, Massachusetts Institute of Technology 183b

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit183a	a	140bp	NON/ShiLt
	b	144bp	A/J, BALB/cJ, LP/J, NOD/MrkTac
	c	152bp	B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, DBA/2J
	d	158bp	AKR/J
	e	170bp	CAST/EiJ
	f	174bp	SPRET/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D10Mit183a	c	136bp	A/JOlaHsd, BALB/cJ, SJL/J
	d	134bp	AKR/OlaHsd, C3H/HeJ, C57BL/6JOlaHsd, C57BL/10, DBA/2J
	p	156bp	129P3/J, JF1, PWB

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit183a	c	148bp	CBA/CaOlaHsd
	D10Mit183a	s	145bp	SWR/OlaHsd

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24