About   Help   FAQ
D4Mit199 Primer Detail
Primers
  • Name
    D4Mit199
  • Primer 1 Sequence
    CTACCATGGTCTCATAAATTGCC
  • Primer 2 Sequence
    TTAGATGGCAAGAGTAAGACAAACA
  • ID
    MGI:702628
  • Product Size
    200
  • Other IDs
    D4Mit199 (BROAD)
  • Note
    MIT assay: MT2391
    Additional information: MIT STS Marker Data Files
Genes
D4Mit199 DNA segment, Chr 4, Massachusetts Institute of Technology 199
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit199 a 187bp CAST/EiJ
b 192bp AKR/J
c 193bp SPRET/EiJ
d 194bp C3H/HeJ
e 196bp BALB/cJ, NOD/MrkTac
f 201bp NON/ShiLt
g 203bp A/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J, LP/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D4Mit199 c 132bp CBA/CaOlaHsd
s 94bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory