D12Mit5 Primer Detail MGI Mouse MGI:702642

D12Mit5 Primer Detail

Name

D12Mit5
Primer 1 Sequence

CACATAGACCAGACAGGCATGCGT
Primer 2 Sequence

CAAGGTCACGTTGCTAGCTAGGAA
ID

MGI:702642
Product Size

48
Other IDs

D12Mit5 (BROAD)
Note

MIT assay: l58
Additional information: MIT STS Marker Data Files

D12Mit5

DNA segment, Chr 12, Massachusetts Institute of Technology 5

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D12Mit5	a	160bp	129X1/Sv
Not Specified	D12Mit5	f	160, 176bp	CD-1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit5	c	160bp	C3HeB/FeJLe
	D12Mit5	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit5	a	141bp	SPRET/EiJ
	b	160bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, CAST/EiJ, DBA/2J, LP/J
	c	176bp	B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac
	d	178bp	NON/ShiLt

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit5	l	smaller	LG/J
	D12Mit5	s	larger	SM/J

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24