D12Mit7 Primer Detail MGI Mouse MGI:702644

D12Mit7 Primer Detail

Name

D12Mit7
Primer 1 Sequence

CCGGGGATCTAAAACTACAT
Primer 2 Sequence

TCTAATCTCAGCCCAATGGT
ID

MGI:702644
Product Size

105
Note

MIT assay: M62

D12Mit7

DNA segment, Chr 12, Massachusetts Institute of Technology 7

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D12Mit7	a	largest	DBA/2
Not Specified	D12Mit7	b	smaller	C57BL/6, JF1, MSM/Ms

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D12Mit7	m	150bp	MOLF/EiJ
Not Specified	D12Mit7	s	135bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit7	a	106bp	NON/ShiLt
	b	108bp	A/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J
	c	121bp	DBA/2J
	d	123bp	AKR/J, BALB/cJ, LP/J, NOD/MrkTac
	e	130bp	CAST/EiJ

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24