D12Mit1 Primer Detail MGI Mouse MGI:702646

D12Mit1 Primer Detail

Name

D12Mit1
Primer 1 Sequence

TACCCGGGGATCTTTTGTTT
Primer 2 Sequence

AAGTGGACTGCCAGAGGATG
ID

MGI:702646
Product Size

229
Note

MIT assay: M50

D12Mit1

DNA segment, Chr 12, Massachusetts Institute of Technology 1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit1	b	smaller	C57BL/6J
	D12Mit1	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit1	a	230bp	B6.Cg-Lep^ob/+, C57BL/6J
	b	244bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt
	c	250bp	SPRET/EiJ
	d	255bp	CAST/EiJ
	e	270bp	LP/J

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24