D3Mit14 Primer Detail MGI Mouse MGI:702683

D3Mit14 Primer Detail

Name

D3Mit14
Primer 1 Sequence

ATTGCGGTTAAAGTTTGCTT
Primer 2 Sequence

TCCTGCAAATTGTCCTCTGA
ID

MGI:702683
Product Size

168
Other IDs

D3Mit14 (BROAD)
Note

MIT assay: M206
Additional information: MIT STS Marker Data Files

D3Mit14

DNA segment, Chr 3, Massachusetts Institute of Technology 14

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D3Mit14	a	largest	DBA/2
		b	smaller	C57BL/6
		c	smallest	JF1, MSM/Ms

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit14	a	127bp	CAST/EiJ
	b	132bp	SPRET/EiJ
	c	170bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J
	d	198bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24