D5Mit424 Primer Detail MGI Mouse MGI:702702

D5Mit424 Primer Detail

Name

D5Mit424
Primer 1 Sequence

GACTCCTCCTCGCCTTTCTT
Primer 2 Sequence

AAAATTACATTTGCATCTGGGG
ID

MGI:702702
Product Size

133
Other IDs

D5Mit424 (BROAD)
Note

MIT assay: MT3586
Additional information: MIT STS Marker Data Files

D5Mit424

DNA Segment, Chr 5, Massachusetts Institute of Technology 424

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit424	a	124bp	A/J, LP/J
	b	126bp	BALB/cJ, DBA/2J
	c	128bp	CAST/EiJ
	d	130bp	NOD/MrkTac
	e	132bp	B6.Cg-Lep^ob/+, C57BL/6J
	f	134bp	AKR/J, C3H/HeJ, NON/ShiLt
	g	144bp	SPRET/EiJ

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D5Mit424	c	lower	CBA/Kw
	D5Mit424	e	upper	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24