D8Mit24 Primer Detail MGI Mouse MGI:702724

D8Mit24 Primer Detail

Name

D8Mit24
Primer 1 Sequence

ACCTCCACACGATTACAGTGG
Primer 2 Sequence

ATGATGTCACCAGCAACTTCC
ID

MGI:702724
Product Size

178
Other IDs

D8Mit24 (BROAD)
Note

MIT assay: A737
Additional information: MIT STS Marker Data Files

D8Mit24

DNA segment, Chr 8, Massachusetts Institute of Technology 24

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D8Mit24	b	smallest	C57BL/6J
	c	168bp	C3HeB/FeJLe
	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D8Mit24	a	160bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J
	b	164bp	SPRET/EiJ
	c	166bp	NOD/MrkTac, NON/ShiLt
	d	168bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J
	e	208bp	CAST/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D8Mit24	c	179bp	CBA/CaOlaHsd
	D8Mit24	s	188bp	SWR/OlaHsd

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24