DXMit80 Primer Detail MGI Mouse MGI:702773

DXMit80 Primer Detail

Name

DXMit80
Primer 1 Sequence

AGGTTGCAATCATCTGGAGG
Primer 2 Sequence

CCATTGGTCCAAGCAAGC
ID

MGI:702773
Product Size

141
Other IDs

DXMit80 (BROAD)
Note

MIT assay: MT590
Additional information: MIT STS Marker Data Files

DXMit80

DNA segment, Chr X, Massachusetts Institute of Technology 80

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
DXMit80	a	123bp	CAST/EiJ
	b	137bp	SPRET/EiJ
	c	141bp	AKR/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NON/ShiLt
	d	145bp	A/J, BALB/cJ, NOD/MrkTac

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
DXMit80	c	146bp	A/JOlaHsd, BALB/cJ
	d	142bp	129P3/J, AKR/OlaHsd, C3H/HeJ, C57BL/6JOlaHsd, DBA/2J, PWB, SJL/J
	j	152bp	JF1
	r	138bp	C57BL/10

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24