D11Mit274 Primer Detail MGI Mouse MGI:702783

D11Mit274 Primer Detail

Name

D11Mit274
Primer 1 Sequence

TTCTAGAAGAAAATGTTGCTGGC
Primer 2 Sequence

TTATGCATTTATGGTGCATATGC
ID

MGI:702783
Product Size

114
Other IDs

D11Mit274 (BROAD)
Note

MIT assay: MJ4766
Additional information: MIT STS Marker Data Files

DNA segment, Chr 11, Massachusetts Institute of Technology 274

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit274	a	90bp	SPRET/EiJ
	b	110bp	CAST/EiJ
	c	112bp	DBA/2J, NON/ShiLt
	d	116bp	A/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, LP/J
	e	124bp	BALB/cJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D11Mit274	a	124bp	AKR/W, BALB/cW, BN/aW
	b	116bp	129/SvW, A.CA/W, C3H/W, C57BL/6W, C57BL/10W, CBA/W
	c	112bp	DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13