About   Help   FAQ
D11Mit274 Primer Detail
Primers
  • Name
    D11Mit274
  • Primer 1 Sequence
    TTCTAGAAGAAAATGTTGCTGGC
  • Primer 2 Sequence
    TTATGCATTTATGGTGCATATGC
  • ID
    MGI:702783
  • Product Size
    114
  • Other IDs
    D11Mit274 (BROAD)
  • Note
    MIT assay: MJ4766
    Additional information: MIT STS Marker Data Files
Genes
D11Mit274 DNA segment, Chr 11, Massachusetts Institute of Technology 274
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit274 a 90bp SPRET/EiJ
b 110bp CAST/EiJ
c 112bp DBA/2J, NON/ShiLt
d 116bp A/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, LP/J
e 124bp BALB/cJ
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D11Mit274 a 124bp AKR/W, BALB/cW, BN/aW
b 116bp 129/SvW, A.CA/W, C3H/W, C57BL/6W, C57BL/10W, CBA/W
c 112bp DBA/2W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory