DXMit89 Primer Detail MGI Mouse MGI:702792

DXMit89 Primer Detail

Name

DXMit89
Primer 1 Sequence

TTCAGTTTTCCCTTCCCATG
Primer 2 Sequence

AGGGAGTTACTGGGAGGGG
ID

MGI:702792
Product Size

146
Other IDs

DXMit89 (BROAD)
Note

MIT assay: MT747
Additional information: MIT STS Marker Data Files

DXMit89

DNA segment, Chr X, Massachusetts Institute of Technology 89

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	DXMit89	a	149bp	129X1/Sv
Not Specified	DXMit89	f	147bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
DXMit89	a	137bp	SPRET/EiJ
	b	147bp	CAST/EiJ
	c	149bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
	d	157bp	C3H/HeJ, DBA/2J, LP/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	DXMit89	a	157bp	129/SvW, C3H/W, DBA/2W
	DXMit89	b	149bp	A.CA/W, AKR/W, BALB/cW, BN/aW, C57BL/6W, C57BL/10W, CBA/W

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24