D12Mit194 Primer Detail MGI Mouse MGI:702799

D12Mit194 Primer Detail

Name

D12Mit194
Primer 1 Sequence

TTCCGCTATCCTCAAGTTGG
Primer 2 Sequence

GTTGACCTCCTTGAGTTGCTG
ID

MGI:702799
Product Size

108
Other IDs

D12Mit194 (BROAD)
Note

MIT assay: MTAR179
Additional information: MIT STS Marker Data Files

DNA segment, Chr 12, Massachusetts Institute of Technology 194

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D12Mit194	a	100bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv
		b	108bp	129X1/SvJ
		c	100, 108bp	CD-1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit194	c	100bp	C3HeB/FeJLe
	D12Mit194	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit194	a	98bp	CAST/EiJ
	b	100bp	A/J, C3H/HeJ, DBA/2J
	c	108bp	AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, LP/J, NON/ShiLt
	d	112bp	NOD/MrkTac
	e	120bp	SPRET/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit194	c	107bp	CBA/CaOlaHsd
	D12Mit194	s	119bp	SWR/OlaHsd

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D12Mit194	a	120bp	BN/aW
	b	108bp	AKR/W, BALB/cW, C57BL/6W, C57BL/10W, CBA/W
	c	100bp	129/SvW, A.CA/W, C3H/W, DBA/2W

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 07/02/2024 MGI 6.13