D17Mit29 Primer Detail MGI Mouse MGI:702824

D17Mit29 Primer Detail

Name

D17Mit29
Primer 1 Sequence

CATCTTTCCAGTCCAAATCTCC
Primer 2 Sequence

CTTCTGGCTTCCTCAACCC
ID

MGI:702824
Product Size

149
Other IDs

D17Mit29 (BROAD)
Note

MIT assay: B238
Additional information: MIT STS Marker Data Files

D17Mit29

DNA segment, Chr 17, Massachusetts Institute of Technology 29

J:23589 Vernet C, et al., Mamm Genome. 1995 Mar;6(3):219-21

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit29	a	smallest	STOCK t¹², STOCK t^w5, STOCK t^w12
	D17Mit29	c	largest	C3H

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit29	a	146bp	A/J, AKR/J, C3H/HeJ, CAST/EiJ
	D17Mit29	b	150bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt

J:23589 Vernet C, et al., Mapping of 12 markers in the proximal region of mouse chromosome 17 using recombinant t haplotypes. Mamm Genome. 1995 Mar;6(3):219-21

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24