D4Mit81 Primer Detail MGI Mouse MGI:702835

D4Mit81 Primer Detail

Name

D4Mit81
Primer 1 Sequence

GACCTGAGTCTTTCTTAAGATGGA
Primer 2 Sequence

GCTTGCTTTTTTGGCTTCTG
ID

MGI:702835
Product Size

160
Other IDs

D4Mit81 (BROAD)
Note

MIT assay: MPC202
Additional information: MIT STS Marker Data Files

D4Mit81

DNA segment, Chr 4, Massachusetts Institute of Technology 81

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit81	a	160bp	AKR/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
	b	186bp	SPRET/EiJ
	c	196bp	CAST/EiJ
	d	204bp	A/J, BALB/cJ, DBA/2J

J:54496 Rogers MJ, et al., Mamm Genome. 1999 May;10(5):513-9

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit81	a	0.17kb	CBA/Ca
	D4Mit81	w	0.24kb	STOCK Whrn^wi

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit81	l	smaller	LG/J
	D4Mit81	s	larger	SM/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit81	a	204bp	BALB/cW, DBA/2W
	D4Mit81	b	160bp	129/SvW, A.CA/W, AKR/W, BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:54496 Rogers MJ, et al., Genetic mapping of the whirler mutation. Mamm Genome. 1999 May;10(5):513-9

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24