D4Mit82 Primer Detail MGI Mouse MGI:702838

D4Mit82 Primer Detail

Name

D4Mit82
Primer 1 Sequence

ATGTGTGCCATTTTGCATGT
Primer 2 Sequence

AGTATTGCTTGATAAATTTGCATG
ID

MGI:702838
Product Size

145
Other IDs

D4Mit82 (BROAD)
Note

MIT assay: MPC1003
Additional information: MIT STS Marker Data Files

D4Mit82

DNA segment, Chr 4, Massachusetts Institute of Technology 82

J:50273 Poltorak A, et al., Blood Cells Mol Dis. 1998 Sep;24(3):340-55

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit82	h	not given	C3H/HeJ
	D4Mit82	s	not given	SWR

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit82	a	130bp	AKR/J, DBA/2J, NOD/MrkTac
	b	140bp	CAST/EiJ
	c	142bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, LP/J, NON/ShiLt
	d	148bp	SPRET/EiJ

J:54496 Rogers MJ, et al., Mamm Genome. 1999 May;10(5):513-9

Gene	Allele	Fragments	Strains
D4Mit82	a	0.157kb	CBA/Ca
	c	0.16kb	CAST/EiJ
	p	0.147kb	STOCK Whrn^wi
	w	0.135kb	STOCK Whrn^wi

J:50273 Poltorak A, et al., Genetic and physical mapping of the Lps locus: identification of the toll-4 receptor as a candidate gene in the critical region. Blood Cells Mol Dis. 1998 Sep;24(3):340-55

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:54496 Rogers MJ, et al., Genetic mapping of the whirler mutation. Mamm Genome. 1999 May;10(5):513-9

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24