D15Mit29 Primer Detail MGI Mouse MGI:702863

D15Mit29 Primer Detail

Name

D15Mit29
Primer 1 Sequence

TCACTCTCCACCTCCCAGAT
Primer 2 Sequence

GTCTGCTTTGTCATAGTGCTGG
ID

MGI:702863
Product Size

149
Other IDs

D15Mit29 (BROAD)
Note

MIT assay: B381
Additional information: MIT STS Marker Data Files

D15Mit29

DNA segment, Chr 15, Massachusetts Institute of Technology 29

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D15Mit29	a	132bp	AKR/J, BALB/cJ, NON/ShiLt
	b	152bp	A/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, LP/J
	c	184bp	CAST/EiJ
	d	186bp	DBA/2J, NOD/MrkTac, SPRET/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D15Mit29	a	186bp	DBA/2W
	b	170bp	129/SvW
	c	152bp	A.CA/W, AKR/W, BALB/cW, BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24