D12Mit172 Primer Detail MGI Mouse MGI:702867

D12Mit172 Primer Detail

Name

D12Mit172
Primer 1 Sequence

AACTGAAATCGCATTACAAAACC
Primer 2 Sequence

TAATATTGCGAGTTAGAAATGACCA
ID

MGI:702867
Product Size

200
Other IDs

D12Mit172 (BROAD)
Note

MIT assay: MT2429
Additional information: MIT STS Marker Data Files

DNA segment, Chr 12, Massachusetts Institute of Technology 172

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit172	c	197bp	C3HeB/FeJLe
	D12Mit172	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit172	a	178bp	SPRET/EiJ
	b	180bp	CAST/EiJ
	c	185bp	DBA/2J, LP/J, NOD/MrkTac
	d	187bp	NON/ShiLt
	e	197bp	A/J, AKR/J, BALB/cJ, C3H/HeJ
	f	199bp	B6.Cg-Lep^ob/+, C57BL/6J

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D12Mit172	c	larger	C58/J
	f	not given	FVB/NJ
	i	not given	I/LnJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit172	c	201bp	CBA/CaOlaHsd
	D12Mit172	s	168bp	SWR/OlaHsd

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24