D12Mit170 Primer Detail MGI Mouse MGI:702873

D12Mit170 Primer Detail

Name

D12Mit170
Primer 1 Sequence

CTGAATCCCCCCTCAATTCT
Primer 2 Sequence

AATCCTTAAGATGCTCAAGTCCC
ID

MGI:702873
Product Size

113
Other IDs

D12Mit170 (BROAD)
Note

MIT assay: MT2360
Additional information: MIT STS Marker Data Files

DNA segment, Chr 12, Massachusetts Institute of Technology 170

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit170	a	110bp	AKR/J, DBA/2J
	b	115bp	B6.Cg-Lep^ob/+, C57BL/6J
	c	129bp	CAST/EiJ
	d	139bp	A/J, BALB/cJ, LP/J, NON/ShiLt
	e	145bp	NOD/MrkTac
	f	146bp	C3H/HeJ
	g	148bp	SPRET/EiJ

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit170	c	larger	CBA/Kw
	D12Mit170	e	smaller	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24