D16Mit88 Primer Detail MGI Mouse MGI:702906

D16Mit88 Primer Detail

Name

D16Mit88
Primer 1 Sequence

GCAAATGTCCACACATGTACC
Primer 2 Sequence

TATGCTTAAATATTATGCCATCTTGC
ID

MGI:702906
Product Size

150
Other IDs

D16Mit88 (BROAD)
Note

MIT assay: MT1309
Additional information: MIT STS Marker Data Files

D16Mit88

DNA segment, Chr 16, Massachusetts Institute of Technology 88

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D16Mit88	c	157bp	C3HeB/FeJLe
	D16Mit88	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D16Mit88	a	116bp	SPRET/EiJ
	b	149bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
	c	157bp	C3H/HeJ
	d	158bp	CAST/EiJ
	e	161bp	DBA/2J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D16Mit88	a	161bp	DBA/2W
	b	157bp	C3H/W, CBA/W
	c	149bp	129/SvW, A.CA/W, AKR/W, BALB/cW, BN/aW, C57BL/6W, C57BL/10W

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D16Mit88	c	larger	CBA/Kw
	D16Mit88	e	smaller	KE

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24