D7Mit178 Primer Detail MGI Mouse MGI:702934

D7Mit178 Primer Detail

Name

D7Mit178
Primer 1 Sequence

ACCTCTGATTTCAGAACCCTTG
Primer 2 Sequence

TAGAGAGCCACTAGCATATCATAACC
ID

MGI:702934
Product Size

200
Other IDs

D7Mit178 (BROAD)
Note

MIT assay: MT1542
Additional information: MIT STS Marker Data Files

D7Mit178

DNA segment, Chr 7, Massachusetts Institute of Technology 178

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D7Mit178	a	165bp	A/J, AKR/J, BALB/cJ, LP/J, NOD/MrkTac, NON/ShiLt
	b	177bp	SPRET/EiJ
	c	187bp	C3H/HeJ, DBA/2J
	d	201bp	B6.Cg-Lep^ob/+, C57BL/6J
	e	211bp	CAST/EiJ

J:71432 Schwarz M, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D7Mit178	a	larger	129P3/J
	D7Mit178	s	smaller	SJL/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D7Mit178	a	210bp	C57BL/6W, C57BL/10W
	b	187bp	C3H/W, CBA/W, DBA/2W
	c	165bp	129/SvW, A.CA/W, AKR/W, BALB/cW, BN/aW

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24