D17Mit113 Primer Detail MGI Mouse MGI:702946

D17Mit113 Primer Detail

Name

D17Mit113
Primer 1 Sequence

TCTGTCTCCTCCGTACTGGG
Primer 2 Sequence

GTCAATAAGTTCAATCACTGAACACA
ID

MGI:702946
Product Size

125
Other IDs

D17Mit113 (BROAD)
Note

MIT assay: MT1230
Additional information: MIT STS Marker Data Files

DNA segment, Chr 17, Massachusetts Institute of Technology 113

J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4

Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit113	c	123bp	BALB/cJ
Not Specified	D17Mit113	s	127bp	129X1/SvJ, C57BL/6J

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit113	a	103bp	CAST/EiJ, DBA/2J
	b	105bp	A/J, C3H/HeJ
	c	113bp	SPRET/EiJ
	d	123bp	AKR/J, BALB/cJ, LP/J
	e	127bp	B6.Cg-Lep^ob/+, C57BL/6J
	f	133bp	NON/ShiLt
	g	137bp	NOD/MrkTac

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit113	c	smaller	CBA/Kw
	D17Mit113	e	larger	KE

J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24