D17Mit112 Primer Detail MGI Mouse MGI:702947

D17Mit112 Primer Detail

Name

D17Mit112
Primer 1 Sequence

CATGCTTTCTCTCTCCCCC
Primer 2 Sequence

AGAGTTGCCTTAAGTGTTGAAGTATG
ID

MGI:702947
Product Size

94
Note

MIT assay: MT1038

DNA segment, Chr 17, Massachusetts Institute of Technology 112

J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4

Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit112	b	95bp	C57BL/6J
Not Specified	D17Mit112	s	97bp	129X1/SvJ, BALB/cJ

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit112	a	95bp	A/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, DBA/2J, NOD/MrkTac
	b	97bp	AKR/J, BALB/cJ, LP/J
	c	105bp	SPRET/EiJ
	d	111bp	CAST/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit112	c	123bp	CBA/CaOlaHsd
	D17Mit112	s	121bp	SWR/OlaHsd

J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24