D2Mit102 Primer Detail MGI Mouse MGI:703000

D2Mit102 Primer Detail

Name

D2Mit102
Primer 1 Sequence

TATTTCCCTGTCACTCCTCCC
Primer 2 Sequence

TGTCTTTATGCTCAGACATACACA
ID

MGI:703000
Product Size

163
Other IDs

D2Mit102 (BROAD)
Note

MIT assay: MPC198
Additional information: MIT STS Marker Data Files

D2Mit102

DNA segment, Chr 2, Massachusetts Institute of Technology 102

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D2Mit102	a	138bp	AKR/J, NOD/MrkTac, NON/ShiLt
	b	162bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J
	c	180bp	C3H/HeJ, SPRET/EiJ
	d	200bp	A/J, BALB/cJ, DBA/2J
	e	216bp	CAST/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D2Mit102	a	200bp	A.CA/W, BALB/cW, DBA/2W
	b	180bp	C3H/W, CBA/W
	c	162bp	C57BL/6W, C57BL/10W
	d	138bp	129/SvW, AKR/W, BN/aW

J:104037 Grzmil P, et al., MGI Direct Data Submission. 2006;

Endonuclease	Gene	Allele	Fragments	Strains
	D2Mit102	c	loser	CBA/Kw
	D2Mit102	k	upper	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:104037 Grzmil P, et al., Mapping of mouse Chromosome 2, 11 STS markers in CBXE and EXCB RI strains. MGI Direct Data Submission. 2006;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24