D8Mit155 Primer Detail MGI Mouse MGI:703020

D8Mit155 Primer Detail

Name

D8Mit155
Primer 1 Sequence

TTGGACAGGGAAAATTCTGC
Primer 2 Sequence

TGAGGACTTGCTTTAAGAGTACTCC
ID

MGI:703020
Product Size

150
Other IDs

D8Mit155 (BROAD)
Note

MIT assay: MT516
Additional information: MIT STS Marker Data Files

D8Mit155

DNA segment, Chr 8, Massachusetts Institute of Technology 155

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D8Mit155	a	75bp	SPRET/EiJ
	b	87bp	CAST/EiJ
	c	115bp	C57BL/6J
	d	139bp	BALB/cJ
	e	147bp	NOD/MrkTac
	f	151bp	A/J, AKR/J, B6.Cg-Lep^ob/+, C3H/HeJ, DBA/2J, LP/J, NON/ShiLt

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D8Mit155	c	143bp	CBA/CaOlaHsd
	D8Mit155	s	132bp	SWR/OlaHsd

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D8Mit155	a	151bp	129/SvW, A.CA/W, AKR/W, BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W, DBA/2W
	D8Mit155	b	139bp	BALB/cW

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 08/02/2024 MGI 6.24