D14Mit38 Primer Detail MGI Mouse MGI:703023

D14Mit38 Primer Detail

Name

D14Mit38
Primer 1 Sequence

TTTCAACTGAGTTATGGTTTTGTG
Primer 2 Sequence

GTGCAAAAAGTACAAAATCTTTGG
ID

MGI:703023
Product Size

142
Other IDs

D14Mit38 (BROAD)
Note

MIT assay: A765
Additional information: MIT STS Marker Data Files

D14Mit38

DNA segment, Chr 14, Massachusetts Institute of Technology 38

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D14Mit38	a	largest	JF1, MSM/Ms
Not Specified	D14Mit38	b	smaller	C57BL/6, DBA/2

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D14Mit38	m	155bp	MOLF/EiJ
Not Specified	D14Mit38	s	170bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D14Mit38	a	142bp	NOD/MrkTac
	b	144bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, NON/ShiLt
	c	152bp	CAST/EiJ, SPRET/EiJ
	d	160bp	LP/J

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24