About   Help   FAQ
D14Mit32 Primer Detail
Primers
  • Name
    D14Mit32
  • Primer 1 Sequence
    ACACCAGAGAGATGAGGAGAGG
  • Primer 2 Sequence
    TCTCTATCCTAAAAGCCCAATCC
  • ID
    MGI:703029
  • Product Size
    232
  • Other IDs
    D14Mit32 (BROAD)
  • Note
    MIT assay: D579
    Additional information: MIT STS Marker Data Files
Genes
D14Mit32 DNA segment, Chr 14, Massachusetts Institute of Technology 32
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D14Mit32 m 266bp MOLF/EiJ
s 242bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D14Mit32 a 228bp SPRET/EiJ
b 236bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt
c 244bp LP/J
d 270bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D14Mit32 c 177bp CBA/CaOlaHsd
s 174bp SWR/OlaHsd
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory