D14Mit32 Primer Detail MGI Mouse MGI:703029

D14Mit32 Primer Detail

Name

D14Mit32
Primer 1 Sequence

ACACCAGAGAGATGAGGAGAGG
Primer 2 Sequence

TCTCTATCCTAAAAGCCCAATCC
ID

MGI:703029
Product Size

232
Other IDs

D14Mit32 (BROAD)
Note

MIT assay: D579
Additional information: MIT STS Marker Data Files

D14Mit32

DNA segment, Chr 14, Massachusetts Institute of Technology 32

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D14Mit32	m	266bp	MOLF/EiJ
Not Specified	D14Mit32	s	242bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D14Mit32	a	228bp	SPRET/EiJ
	b	236bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt
	c	244bp	LP/J
	d	270bp	CAST/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D14Mit32	c	177bp	CBA/CaOlaHsd
	D14Mit32	s	174bp	SWR/OlaHsd

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13