D14Mit30 Primer Detail MGI Mouse MGI:703031

D14Mit30 Primer Detail

Name

D14Mit30
Primer 1 Sequence

ATTTGGTGTTGAGGCCATGT
Primer 2 Sequence

CTTTGTCCTTTGTCATCAAAAGG
ID

MGI:703031
Product Size

153
Note

MIT assay: A777

D14Mit30

DNA segment, Chr 14, Massachusetts Institute of Technology 30

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D14Mit30	a	116bp	129X1/Sv
Not Specified	D14Mit30	f	134bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D14Mit30	a	116bp	C3H/HeJ, DBA/2J, LP/J
	b	134bp	NON/ShiLt
	c	142bp	SPRET/EiJ
	d	146bp	A/J, AKR/J, NOD/MrkTac
	e	150bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13