About   Help   FAQ
D14Mit109 Primer Detail
Primers
  • Name
    D14Mit109
  • Primer 1 Sequence
    GAATTATCTGGAACTTACTTCCTTTTT
  • Primer 2 Sequence
    TCTGATGGTGCTTATATGCCC
  • ID
    MGI:703034
  • Product Size
    116
  • Other IDs
    D14Mit109 (BROAD)
  • Note
    MIT assay: MTH111
    Additional information: MIT STS Marker Data Files
Genes
D14Mit109 DNA segment, Chr 14, Massachusetts Institute of Technology 109
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D14Mit109 a 88bp CAST/EiJ
b 94bp BALB/cJ, NOD/MrkTac
c 118bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, NON/ShiLt
d 120bp A/J
e 124bp C3H/HeJ, DBA/2J, LP/J
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D14Mit109 a 114bp A/JOlaHsd, AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10
c 90bp BALB/cJ, SJL/J
d 118bp 129P3/J, C3H/HeJ, DBA/2J, JF1
p 116bp PWB
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory