D14Mit109 Primer Detail MGI Mouse MGI:703034

D14Mit109 Primer Detail

Name

D14Mit109
Primer 1 Sequence

GAATTATCTGGAACTTACTTCCTTTTT
Primer 2 Sequence

TCTGATGGTGCTTATATGCCC
ID

MGI:703034
Product Size

116
Other IDs

D14Mit109 (BROAD)
Note

MIT assay: MTH111
Additional information: MIT STS Marker Data Files

DNA segment, Chr 14, Massachusetts Institute of Technology 109

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D14Mit109	a	88bp	CAST/EiJ
	b	94bp	BALB/cJ, NOD/MrkTac
	c	118bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, NON/ShiLt
	d	120bp	A/J
	e	124bp	C3H/HeJ, DBA/2J, LP/J

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D14Mit109	a	114bp	A/JOlaHsd, AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10
	c	90bp	BALB/cJ, SJL/J
	d	118bp	129P3/J, C3H/HeJ, DBA/2J, JF1
	p	116bp	PWB

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24