About   Help   FAQ
D5Mit146 Primer Detail
Primers
  • Name
    D5Mit146
  • Primer 1 Sequence
    TTAAATCTGAAGGTGTGGCTATAGC
  • Primer 2 Sequence
    GAGATTGCAAGTAAAGTGAGAGAGG
  • ID
    MGI:703040
  • Product Size
    126
  • Other IDs
    D5Mit146 (BROAD)
  • Note
    MIT assay: MT72
    Additional information: MIT STS Marker Data Files
Genes
D5Mit146 DNA segment, Chr 5, Massachusetts Institute of Technology 146
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit146 a 100bp CAST/EiJ
b 120bp LP/J
c 122bp A/J, C3H/HeJ, DBA/2J
d 124bp AKR/J
e 126bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, NON/ShiLt
f 128bp NOD/MrkTac, SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D5Mit146 c 110bp CBA/CaOlaHsd
s 114bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
12/17/2024
MGI 6.24 		The Jackson Laboratory