About   Help   FAQ
D5Mit145 Primer Detail
Primers
  • Name
    D5Mit145
  • Primer 1 Sequence
    TATCAGCAATACAGACTCAGTAGGC
  • Primer 2 Sequence
    TGCCCCTTAAATTCATGGTC
  • ID
    MGI:703043
  • Product Size
    150
  • Other IDs
    D5Mit145 (BROAD)
  • Note
    MIT assay: MT1144
    Additional information: MIT STS Marker Data Files
Genes
D5Mit145 DNA segment, Chr 5, Massachusetts Institute of Technology 145
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit145 a 97bp NOD/MrkTac
b 109bp NON/ShiLt
c 121bp BALB/cJ, CAST/EiJ
d 125bp AKR/J, LP/J, SPRET/EiJ
e 149bp A/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D5Mit145 c 121bp CBA/CaOlaHsd
s 123bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory