D2Mit22 Primer Detail MGI Mouse MGI:703058

D2Mit22 Primer Detail

Name

D2Mit22
Primer 1 Sequence

GCTCCCTTTCCTCTTGAACC
Primer 2 Sequence

GGGCCCTTATTCTATCTCCC
ID

MGI:703058
Product Size

189
Other IDs

D2Mit22 (BROAD)
Note

MIT assay: M167
Additional information: MIT STS Marker Data Files

D2Mit22

DNA segment, Chr 2, Massachusetts Institute of Technology 22

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D2Mit22	m	155bp	MOLF/EiJ
Not Specified	D2Mit22	s	162bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D2Mit22	a	112bp	SPRET/EiJ
	b	147bp	NOD/MrkTac, NON/ShiLt
	c	162bp	CAST/EiJ
	d	190bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D2Mit22	l	smaller	LG/J
	D2Mit22	s	larger	SM/J

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24