About   Help   FAQ
D2Mit22 Primer Detail
Primers
  • Name
    D2Mit22
  • Primer 1 Sequence
    GCTCCCTTTCCTCTTGAACC
  • Primer 2 Sequence
    GGGCCCTTATTCTATCTCCC
  • ID
    MGI:703058
  • Product Size
    189
  • Other IDs
    D2Mit22 (BROAD)
  • Note
    MIT assay: M167
    Additional information: MIT STS Marker Data Files
Genes
D2Mit22 DNA segment, Chr 2, Massachusetts Institute of Technology 22
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D2Mit22 m 155bp MOLF/EiJ
s 162bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit22 a 112bp SPRET/EiJ
b 147bp NOD/MrkTac, NON/ShiLt
c 162bp CAST/EiJ
d 190bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D2Mit22 l smaller LG/J
s larger SM/J
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory