About   Help   FAQ
D11Mit99 Primer Detail
Primers
  • Name
    D11Mit99
  • Primer 1 Sequence
    CTGTAGGTAAAATACACTTGCCG
  • Primer 2 Sequence
    GGTGGACAGACCCTTCTGAA
  • ID
    MGI:703065
  • Product Size
    122
  • Other IDs
    D11Mit99 (BROAD)
  • Note
    MIT assay: MPC2037
    Additional information: MIT STS Marker Data Files
Genes
D11Mit99 DNA segment, Chr 11, Massachusetts Institute of Technology 99
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit99 a 107bp C3H/HeJ
b 108bp DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
c 118bp A/J
d 120bp SPRET/EiJ
e 121bp AKR/J
f 122bp CAST/EiJ
g 123bp BALB/cJ
h 124bp B6.Cg-Lepob/+, C57BL/6J
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D11Mit99 c larger C58/J
f not given FVB/NJ
i not given I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D11Mit99 c 121bp CBA/CaOlaHsd
s 106bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
06/12/2024
MGI 6.13 		The Jackson Laboratory