D6Mit104 Primer Detail MGI Mouse MGI:703079

D6Mit104 Primer Detail

Name

D6Mit104
Primer 1 Sequence

CTCCAAATGCATGTGGACAC
Primer 2 Sequence

CATCCCTCATGCCTCTGC
ID

MGI:703079
Product Size

144
Other IDs

D6Mit104 (BROAD)
Note

MIT assay: MPC2468
Additional information: MIT STS Marker Data Files

D6Mit104

DNA segment, Chr 6, Massachusetts Institute of Technology 104

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D6Mit104	a	146bp	129X1/Sv
Not Specified	D6Mit104	f	146, 154bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D6Mit104	a	122bp	SPRET/EiJ
	b	146bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
	c	154bp	A/J, BALB/cJ, DBA/2J
	d	158bp	AKR/J, C3H/HeJ
	e	162bp	CAST/EiJ

J:156851 Golas A, MGI Direct Data Submission. 2010;

Endonuclease	Gene	Allele	Fragments	Strains
	D6Mit104	b	upper	C57BL/6J
	D6Mit104	s	lower	129/Sv

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:156851 Golas A, Microsatellite differences on Chromosome 3, 6, 11 and 12 in C57BL/6J and 129/Sv strains and Mapping in CBXE RI line. MGI Direct Data Submission. 2010;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13