D19Mit19 Primer Detail MGI Mouse MGI:703125

D19Mit19 Primer Detail

Name

D19Mit19
Primer 1 Sequence

CCTGTGTCCATACAGGCTCA
Primer 2 Sequence

ACCATATCAGGAAGCACCATG
ID

MGI:703125
Product Size

138
Other IDs

D19Mit19 (BROAD)
Note

MIT assay: A658
Additional information: MIT STS Marker Data Files

D19Mit19

DNA segment, Chr 19, Massachusetts Institute of Technology 19

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D19Mit19	m	145bp	MOLF/EiJ
Not Specified	D19Mit19	s	127bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D19Mit19	a	98bp	CAST/EiJ
	b	116bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	c	142bp	B6.Cg-Lep^ob/+, C57BL/6J
	d	144bp	SPRET/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D19Mit19	a	142bp	C57BL/6W, C57BL/10W
	D19Mit19	b	116bp	129/SvW, A.CA/W, AKR/W, BALB/cW, BN/aW, C3H/W, CBA/W, DBA/2W

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/09/2024 MGI 6.24