About   Help   FAQ
D19Mit13 Primer Detail
Primers
  • Name
    D19Mit13
  • Primer 1 Sequence
    TCTGGCACAAAGAGTTCGTG
  • Primer 2 Sequence
    CTTTTGCAGGAGCAGGTAGG
  • ID
    MGI:703128
  • Product Size
    248
  • Other IDs
    D19Mit13 (BROAD)
  • Note
    MIT assay: A871
    Additional information: MIT STS Marker Data Files
Genes
D19Mit13 DNA segment, Chr 19, Massachusetts Institute of Technology 13
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D19Mit13 b smaller C57BL/6J
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit13 a 246bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
b 248bp CAST/EiJ
c 262bp C3H/HeJ, DBA/2J
d 288bp SPRET/EiJ
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D19Mit13 a 270bp C3H/W, DBA/2W
b 260bp 129/SvW, A.CA/W, BN/aW, CBA/W
c 246bp AKR/W, BALB/cW, C57BL/6W, C57BL/10W
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D19Mit13 c larger CBA/Kw
e smaller KE
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/03/2024
MGI 6.24
The Jackson Laboratory